genome sequencing and analysis program and platform  (Broad Institute Inc)

Journal: Cell Reports Methods

Article Title: MR1-ligand cross-linking identifies vitamin B6 metabolites as TCR-reactive antigens

doi: 10.1016/j.crmeth.2025.101120

Figure Lengend Snippet: Workflow for MR1-dependent antigen discovery by protein-metabolite cross-linking (1) Cells presenting antigens on MR1 were lysed, followed by (2) strep-tag-based enrichment of MR1 from the lysate. (3) The unstable Schiff base that formed between the ligand and the MR1 K43 residue was subsequently stabilized using reductive amination followed by (4) proteolytic digest, giving rise to the K43-specific DSVTRQ K EPRAPW peptide . (5) Peptide samples were analyzed by bottom-up LC-MS/MS. (6) Data were scoured for evidence of variable modification on the MR1-specific K43 peptide DSVTRQ K EPRAPW using a combination of mass shift analysis and peptide sequence-specific reporter ions. (7) Mass shifts of potential ligands were shortlisted according to their potential chemical composition and (8) validated biochemically by their ability to induce MR1 surface expression in cells, as measured by flow cytometry. See also .

Article Snippet: DNA samples were sent to Eurofins Genomics sequencing platform using the following primers: pELNS Forward: 5′ GAGTTTGGATCTTGGTTCATTC 3′ and rat (r) CD2 Reverse: 5′ AACTTGCACCGCATATGCAT 3’.

Techniques: Strep-tag, Residue, Liquid Chromatography with Mass Spectroscopy, Modification, Sequencing, Expressing, Flow Cytometry

Journal: Cell Reports Methods

Article Title: MR1-ligand cross-linking identifies vitamin B6 metabolites as TCR-reactive antigens

doi: 10.1016/j.crmeth.2025.101120

Figure Lengend Snippet: Reductive amination of Ac-6-FP with synthetic DSVTRQ K EPRAPW peptide and within the MR1-binding pocket (A–D) Proof of concept for cross-linking reaction using synthetic DSVTRQ K EPRAPW and the well-established MR1 ligand Ac-6-FP in vitro . (A) Representative spectrum from triplicate analysis for a peptide identification by PEAKS defining Ac-6-FP as a variable modification. Sequence-specific b-ions (purple) and y-ions (blue) are annotated in the spectra and visualized in the peptide sequence. Red lines pointing to the right above the peptide sequence indicate the presence of a position-specific y-ion, and red lines pointing to the left below the peptide sequence indicate presence of a position-specific b-ion. (B) Representative extracted ion chromatograms (XICs) of the Ac-6-FP-bound DSVTRQ K EPRAPW precursor, including the three most abundant isotopes (M, M+1, and M+2). The horizontal axis represents chromatographic retention time (RT) in minutes (min). (C) Reaction yields were assessed by calculating ratios of the chromatographic area under the curve (AUC) of Ac-6-FP-bound DSVTRQ K EPRAPW and unmodified DSVTRQ K EPRAPW at various reaction conditions, suggesting an improved yield at lower concentrations of NaCNBH 3 . Experiments were performed in triplicate, with error bars indicating standard deviations. (D) Similarly, AUCs for free Ac-6-FP decrease at higher NaCNBH 3 concentrations, indicating the possibility of an off-target reduction reaction happening in increased reducing conditions prior to cross-link formation. Experiments were performed in triplicate, with error bars indicating standard deviations. (E and F) Proof of concept for cross-linking reaction within the MR1 binding groove. (E) Diclofenac-loaded recombinant MR1/β2M complexes were incubated with Ac-6-FP to induce ligand exchange and perform reductive amination at 5 different NaCNBH 3 concentrations. (F) Representative XICs for the reaction product after chymotryptic digestion in comparison to the non-cross-linked peptide. The product was detected in all five experimental conditions tested. See also .

Article Snippet: DNA samples were sent to Eurofins Genomics sequencing platform using the following primers: pELNS Forward: 5′ GAGTTTGGATCTTGGTTCATTC 3′ and rat (r) CD2 Reverse: 5′ AACTTGCACCGCATATGCAT 3’.

Techniques: Binding Assay, In Vitro, Modification, Sequencing, Recombinant, Incubation, Comparison

Journal: Cell Reports Methods

Article Title: MR1-ligand cross-linking identifies vitamin B6 metabolites as TCR-reactive antigens

doi: 10.1016/j.crmeth.2025.101120

Figure Lengend Snippet: Development of an enrichment strategy for MR1-dependent antigen discovery by protein-metabolite cross-linking and de novo MR1 antigen discovery (A) Schematic of a recombinant platform to express fully functional, C-terminally-tagged single-chain MR1/β2M (scMR1) molecules with either lysine or alanine at position 43, developed for high-specificity MR1 enrichment. The alpha 1, 2, 3, and transmembrane (TM) domains of MR1 are depicted. (B) MR1 staining of A549 (left) and MM909.24 (right) cell lines, either wild type (WT), MR1 knockout (MR1 KO), and MR1 KO cells transduced with scMR1 (MR1 KO + scMR1-WT) and mutant scMR1 (MR1 KO + scMR1-K43A). Numbers in the left-hand corner are the MR1-specific Allophycocyanin (APC) mean fluorescence intensities (staining with anti-MR1 26.5 antibody clone). Gates are set for viable, single cells. (C) Overnight activation assay with MAIT cell TCR-T (primary CD8 + T cells transduced with A-F7 MAIT TCR) versus M. smegmatis -infected and uninfected A549 cells followed by a tumor necrosis factor (TNF) ELISA confirming MAIT cell recognition of scMR1 in the presence of endogenous antigen. Error bars depict the standard deviation of duplicate conditions. (D) Enrichment efficiency obtained from MM909.24 cells stably transduced with scMR1-K43 molecules based on protein abundances obtained by LC-MS/MS (MR1 and β2M are highlighted separately as red dots that overlap). (E) Proof of concept for the detection of MR1/Ac-6-FP cross-link in a cell-based system. scMR1-transfected MM909.24 melanoma cells pulsed with 50 μM Ac-6-FP for 16 h were subjected to the cross-linking workflow. The graph shows extracted ion chromatograms for DSVTRQ K EPRAPW and DSVTRQ K EPRAPW bound to Ac-6-FP, respectively, including the three most abundant isotopes (M, M+1, and M+2) for each of the two peptide variants. (F) Schematic of the data analysis workflow employed to detect DSVTRQ K EPRAPW cross-linked to unknown ligands. Peptide sequence ladder ions unaffected by the ligand (y1–y6 and b1–b6) were used as reporter ions. MS/MS spectra containing these ions were subsequently shortlisted. Subtraction of the theoretical DSVTRQ K EPRAPW peptide mass generates Δ-mass values for cross-linked ligands that can be corrected for the mass of the free ligand, which can be queried for candidate compounds using tools such as CEU mass mediator. (G and H) Applied to scMR1-transfected MM909.24 pulsed with 50 μM Ac-6-FP for 16 h, the data analysis pipeline successfully detected spectra indicating the presence of other ligands bound to MR1, such as 6-formylpterin (XIC, G) and methylglyoxal (XIC, H). See also and and .

Article Snippet: DNA samples were sent to Eurofins Genomics sequencing platform using the following primers: pELNS Forward: 5′ GAGTTTGGATCTTGGTTCATTC 3′ and rat (r) CD2 Reverse: 5′ AACTTGCACCGCATATGCAT 3’.

Techniques: Recombinant, Functional Assay, Staining, Knock-Out, Transduction, Mutagenesis, Fluorescence, Activation Assay, Infection, Enzyme-linked Immunosorbent Assay, Standard Deviation, Stable Transfection, Liquid Chromatography with Mass Spectroscopy, Transfection, Sequencing, Tandem Mass Spectroscopy

Journal: Cell Reports Methods

Article Title: MR1-ligand cross-linking identifies vitamin B6 metabolites as TCR-reactive antigens

doi: 10.1016/j.crmeth.2025.101120

Figure Lengend Snippet: Discovery and validation of pyridoxal as MR1 ligand (A and B) scMR1-transfected A549 cells were subjected to reductive cross-linking, shortlisting pyridoxal as a candidate ligand. Data are shown for (A) the annotated fragment spectrum for K43-bound pyridoxal (sequence-specific b- and y-ions are depicted in purple and blue, respectively, in the spectra, with their respective mass error in ppm depicted above) and (B) the corresponding extracted ion chromatogram. (C–H) Corresponding data for replicates 2–4. See also and .

Article Snippet: DNA samples were sent to Eurofins Genomics sequencing platform using the following primers: pELNS Forward: 5′ GAGTTTGGATCTTGGTTCATTC 3′ and rat (r) CD2 Reverse: 5′ AACTTGCACCGCATATGCAT 3’.

Techniques: Biomarker Discovery, Transfection, Sequencing